This tool predicts the most probable miRNA duplex on a given miRNA hairpin. You can upload a txt file with your sequences in fasta format, (include fasta file header). Output is a three columns tab delimited table. The first column specifies the sequences IDs as they were specified by the user, the second and the third columns shows the most probable matures from the 5' and the 3' strand of the hairpin respectively. Entries for which the RNAfold output is not a hairpin or consists of multiple stems are filtered out and 'Multibranch - No prediction' is returned as an output at the respective line. An e-mail could be provided in order to receive your results (optional). Thank you for using MiRduplexSVM! Input example: >MI0000060 UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA >MI0000061 AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU >MI0000065 CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGG >MI0003603 UCUUAUCAAUGAGGUAGACCAUGGGUUCUCAUUGUAAUAGUGUAGAAUGUUGGUUAACUGUGGACUCCCUGGCUCUGUCUCAAAUCUACUGAUUC >MI0000070 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC >MI0003681 GUGUAGUAGAGCUAGGAGGAGAGGGUCCUGGAGAAGCGUGGACCGGUCCGGGUGGGUUCCGGCAGGUUCUCACCCUCUCUAGGCCCCAUUCUCCUCUG >MI0000071 GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC Output example: MI0000060 UGAGGUAGUAGGUUGUAUAGUU CUAUACAAUCUACUGUCUUUC MI0000061 UGAGGUAGUAGGUUGUAUAGUU CUGUACAGCCUCCUAGCUUUCC MI0000065 AGAGGUAGUAGGUUGCAUAGUU CUAUACGACCUGCUGCCUUUC MI0003603 Multibranch No prediction MI0000070 UAGCAGCACGUAAAUAUUGGCG CCAGUAUUAACUGUGCUGCUGA MI0003681 Multibranch No prediction MI0000071 CAAAGUGCUUACAGUGCAGGUAG ACUGCAGUGAAGGCACUUGUAG