It evaluates a miRNA mature by assigning MiRduplexSVM's score and predicts the mature molecule that lies on the opposite strand. You can upload two txt files with your sequences in fasta format, (include fasta file header). The one file should have the miRNA precursor sequences and the other should include the respective mature miRNA sequences. Output is a four columns tab delimited table. The first column specifies the sequences IDs as they were specified by the user, the second and the third columns show the matures from the 5' and the 3' strand of the hairpin respectively, the fourth column represents MiRduplexSVM's score. One mature correspond to the one has been provided by the user and the other one is the program's prediction. Entries for which the RNAfold output is not a hairpin or consists of multiple stems are filtered out and 'Multibranch - No prediction' is returned as an output at the respective line. An e-mail could be provided in order to receive your results (optional). Thank you for using MiRduplexSVM: Evaluator - Missing duplex finder! Input example - precursors sequences: >MI0000064 GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUAC AACCUUCUAGCUUUCCUUGGAGC >MI0000238 GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCAC CCGAUUCAC >MI0003603 UCUUAUCAAUGAGGUAGACCAUGGGUUCUCAUUGUAAUAGUGUAGAAUGUUGGUUAACUG UGGACUCCCUGGCUCUGUCUCAAAUCUACUGAUUC >MI0000240 UCAUUGGUCCAGAGGGGAGAUAGGUUCCUGUGAUUUUUCCUUCUUCUCUAUAGAAUAAAU GA >MI0003681 GUGUAGUAGAGCUAGGAGGAGAGGGUCCUGGAGAAGCGUGGACCGGUCCGGGUGGGUUCCG GCAGGUUCUCACCCUCUCUAGGCCCCAUUCUCCUCUG >MI0000265 AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAUUUUGUUGUUCUGAUG UACUACGACAACAAGUCACAGCCGGCCUCAUAGCGCAGACUCCCUUCGAC >MI0000291 AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAGCUGAGU UUGUCUGUCAUUUCUUUAGGCCAAUAUUCUGUAUGACUGUGCUACUUCAA Input example - mature sequences: >MI0000064 UGAGGUAGUAGGUUGUAUGGUU >MI0000238 UAGGUAGUUUCAUGUUGUUGGG >MI0003603 AGACCAUGGGUUCUCAUUGU >MI0000240 GGUCCAGAGGGGAGAUAGGUUC >MI0003681 GGCAGGUUCUCACCCUCUCUAGG >MI0000265 UGGAAGACUAGUGAUUUUGUUGU >MI0000291 AUGACCUAUGAAUUGACAGAC Output example: sequenceID 5strandMature 3strandMature MiRduplexSVMscore MI0000064 UGAGGUAGUAGGUUGUAUGGUU CUGUACAACCUUCUAGCUUUCC 1.258655e+00 MI0000238 UAGGUAGUUUCAUGUUGUUGGG CAACAACAUUAAACCACCCGAU 6.887440e01 MI0003603 Multibranch No prediction MI0000240 GGUCCAGAGGGGAGAUAGGUUC UCCUUCUUCUCUAUAGAAUAAA 8.162919e01 MI0003681 Multibranch No prediction MI0000265 UGGAAGACUAGUGAUUUUGUUGU CAACAAGUCACAGCCGGCCUCA 1.256639e+00 MI0000291 AUGACCUAUGAAUUGACAGAC UCUGUCAUUUCUUUAGGCCAAU 7.194692e01