MiRduplexSVM: miRNA Evaluator - Missing duplex finder

It  evaluates  a miRNA mature by  assigning MiRduplexSVM's score and  predicts  the 
mature molecule that lies on the opposite strand.

You can upload two  txt  files  with  your sequences in fasta format, (include fasta 
file header).  The one file should  have the miRNA precursor  sequences and the 
other should include the respective mature miRNA sequences.

Output is a four  columns tab delimited table. The first column specifies the sequences
IDs as they were specified by the user, the second and the third columns show the 
matures from the 5' and the 3' strand  of the hairpin respectively, the fourth column 
represents MiRduplexSVM's score. One mature correspond to the one has been provided 
by the user and the other one is the program's prediction. Entries for which the RNAfold 
output is not a hairpin or consists of multiple stems are filtered out and 'Multibranch -No prediction' is returned as an output at the respective line.
An e-mail could be provided in order to receive your results.

Thank you for using MiRduplexSVM: Evaluator - Missing duplex finder


Input example - precursors sequences:
>MI0000064
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUAC
AACCUUCUAGCUUUCCUUGGAGC
>MI0000238
GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCAC
CCGAUUCAC
>MI0003603
UCUUAUCAAUGAGGUAGACCAUGGGUUCUCAUUGUAAUAGUGUAGAAUGUUGGUUAACUG
UGGACUCCCUGGCUCUGUCUCAAAUCUACUGAUUC
>MI0000240
UCAUUGGUCCAGAGGGGAGAUAGGUUCCUGUGAUUUUUCCUUCUUCUCUAUAGAAUAAAU
GA
>MI0003681
GUGUAGUAGAGCUAGGAGGAGAGGGUCCUGGAGAAGCGUGGACCGGUCCGGGUGGGUUCCG
GCAGGUUCUCACCCUCUCUAGGCCCCAUUCUCCUCUG
>MI0000265
AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAUUUUGUUGUUCUGAUG
UACUACGACAACAAGUCACAGCCGGCCUCAUAGCGCAGACUCCCUUCGAC
>MI0000291
AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAGCUGAGU
UUGUCUGUCAUUUCUUUAGGCCAAUAUUCUGUAUGACUGUGCUACUUCAA


Input example - mature sequences:
>MI0000064
UGAGGUAGUAGGUUGUAUGGUU
>MI0000238
UAGGUAGUUUCAUGUUGUUGGG
>MI0003603
AGACCAUGGGUUCUCAUUGU
>MI0000240
GGUCCAGAGGGGAGAUAGGUUC
>MI0003681
GGCAGGUUCUCACCCUCUCUAGG 
>MI0000265
UGGAAGACUAGUGAUUUUGUUGU
>MI0000291
AUGACCUAUGAAUUGACAGAC


 Output example:
sequenceID      5strandMature        3strandMature           MiRduplexSVM­score
MI0000064       UGAGGUAGUAGGUUGUAUGGUU   CUGUACAACCUUCUAGCUUUCC    1.258655e+00
MI0000238       UAGGUAGUUUCAUGUUGUUGGG   CAACAACAUUAAACCACCCGAU    6.887440e­01
MI0003603       Multibranch ­ No prediction
MI0000240       GGUCCAGAGGGGAGAUAGGUUC   UCCUUCUUCUCUAUAGAAUAAA    ­8.162919e­01
MI0003681       Multibranch ­ No prediction
MI0000265       UGGAAGACUAGUGAUUUUGUUGU  CAACAAGUCACAGCCGGCCUCA    1.256639e+00
MI0000291       AUGACCUAUGAAUUGACAGAC    UCUGUCAUUUCUUUAGGCCAAU    7.194692e­01


Upload FASTA files:
Upload FASTA file of precursors (include fasta file header):


Upload FASTA file of matures (include fasta file header):


Paste FASTA data: FASTA data of precursors (include fasta file header):

FASTA data of matures (include fasta file header):


Enter your email to receive results (optional):
Please enter your email address to receive the results when DuplexSVM is done processing


MissingDuplexFinder takes 10-30 minutes to complete. You will receive the results in the email address you specified above.